Okołooperacyjna rozuwastatyna w kardiochirurgii cd

Pooperacyjny zawał mięśnia sercowego został zdiagnozowany według Thygesen i wsp., 23 i ostre uszkodzenie nerek zgodnie z kryteriami sieci ostrej niewydolności nerek.24 Dodatkowe szczegóły znajdują się w sekcji Metody w dodatkowym dodatku. Analiza statystyczna
Na podstawie danych z poprzednich badań oszacowaliśmy, że pooperacyjna częstość występowania migotania przedsionków w grupie kontrolnej (placebo) wynosiłaby około 35% .25 Pierwotnie obliczyliśmy, że 1000 pacjentów musiałoby zostać poddanych randomizacji, aby badanie miało ponad 80% mocy, na poziomie istotności 0,05, w celu wykrycia względnej różnicy 25% w częstości występowania migotania przedsionków i względnej różnicy 15% w obszarze pod krzywą uwalniania troponiny I. W miarę postępu rekrutacji stwierdzono, że oślepiona częstość migotania przedsionków w dwóch połączonych grupach próbnych wynosiła w przybliżeniu 20%. W związku z tym próbkę zwiększono do około 1900 pacjentów, aby próbka zachowała moc co najmniej 80%, na poziomie istotności 0,05, w celu wykrycia względnej różnicy 30% w częstości migotania przedsionków.
Użyliśmy ilorazów szans i 95% przedziałów ufności dla porównań między grupami pierwotnego wyniku migotania przedsionków i dla innych wyników dychotomicznych i metod rangowania logarytmicznego dla oceny czasu pobytu na OIOM i całkowitego pobytu w szpitalu26. wynik porównawczy uszkodzenia mięśnia sercowego, analiza kowariancji (ANCOVA) użyto do porównania średniego obszaru kłody pod krzywą uwalniania troponiny I między 6 godzinami i 120 godzinami po operacji, z dostosowaniem do stężenia troponiny I na linii podstawowej. ANCOVA zastosowano również do porównania innych biomarkerów i pomiarów echokardiograficznych po operacji, z korektą dla wartości wyjściowych. Continue reading “Okołooperacyjna rozuwastatyna w kardiochirurgii cd”

Medicaid i droga USA do krajowego ubezpieczenia zdrowotnego

Wybory prezydenckie w 2008 r. Rozpaliły długo oczekiwaną nadzieję na kompleksową reformę systemu opieki zdrowotnej. Debata polityczna zawiera odniesienia do nowych programów rządowych (być może program federalny dla nieubezpieczonych, które można kupić) i niejasne formuły dotyczące ograniczania kosztów (zazwyczaj z nadmiernie optymistyczną oceną oszczędności, które można uzyskać dzięki wykorzystaniu technologii informacji o zdrowiu). Jak na ironię, debata generalnie ignoruje to, co uważam za najbardziej wiarygodną drogę do powszechnego pokrycia: po pierwsze, rozszerzenie Medicaid o pokrycie największej części nieubezpieczonych, Amerykanów o dochodach poniżej 350% federalnego poziomu ubóstwa (około 62 000 USD dla rodziny trzech); po drugie, wymaganie od wszystkich posiadania ubezpieczenia zdrowotnego i umożliwienie ludziom, których dochody są zbyt wysokie, aby automatycznie objęli ubezpieczenie medyczne. Poprzednie wysiłki zmierzające do uchwalenia powszechnego zasięgu zawiodły częściowo dlatego, że opozycja ze strony grup interesu, takich jak środowisko biznesowe i branża ubezpieczeniowa, ma znacznie większy wpływ niż zorganizowane wsparcie dla nieubezpieczonych pracowników niskopłatnych. Continue reading “Medicaid i droga USA do krajowego ubezpieczenia zdrowotnego”

Kontynuacja intensywnej kontroli poziomu glukozy w cukrzycy typu 2

Brytyjskie prospektywne badanie cukrzycy (UKPDS) zgłoszone przez Holmana i wsp. (Wydanie 9 października) pokazuje dotychczasowy efekt intensywnej kontroli glikemii (w grupie metforminy oraz w grupie otrzymującej sulfonylomocznik lub insulinę) na podstawie wyników klinicznych u pacjentów ze świeżo zdiagnozowaną cukrzycą typu 2. UKPDS wpłynął na międzynarodowe wytyczne leczenia2, prowadząc do zalecenia stosowania metforminy jako wstępnej terapii farmakologicznej u wszystkich pacjentów z cukrzycą typu 2. Oryginalne badanie UKPDS porównywało dane dotyczące wyników u pacjentów, którzy otrzymywali metforminę w porównaniu z terapią konwencjonalną (ograniczenie dietetyczne) lub intensywną terapią (sulfonylomocznikiem lub insulinoterapią). 3 Nie opisano jednak porównań pomiędzy grupą metforminy i grupą pochodną sulfonylomocznika lub insuliny. Continue reading “Kontynuacja intensywnej kontroli poziomu glukozy w cukrzycy typu 2”

Ocena wpływu zanieczyszczenia powietrza atmosferycznego na długość życia ad

Długoterminowe skutki narażenia na kryteria zanieczyszczeń powietrza (pyły zawieszone, ozon, siarczany, dwutlenek siarki, tlenki azotu i tlenek węgla) zostały udokumentowane w dużych badaniach kohortowych, w tym w Harvard Six Cities Study8 i American Cancer Society Cancer Prevention Studium II.9 Kohorta Amerykańskiego Towarzystwa Onkologicznego, która obejmuje ponad 1,1 miliona osób, które śledziły od czasu rejestracji w 1980 roku, dostarczyła spójnych dowodów na związek między zwiększoną śmiertelnością a zanieczyszczeniem otaczającego powietrza w dalszych analizach poprzez 1999,10 198,18 i 20009 (tabela 1). Trwają dalsze analizy danych przy użyciu udoskonalonych szacunków narażenia na warunki otoczenia PM2,5 i działania następcze do 2004 r. Skutki zanieczyszczenia powietrza atmosferycznego na zdrowie populacji można rozwiązać w szerszym kontekście oceny i zarządzania ryzykiem. Ocena ryzyka dla populacji obejmuje systematyczną ocenę uwarunkowań genetycznych, środowiskowych i społecznych zdrowia; zidentyfikowane zagrożenia dla zdrowia można rozwiązać za pomocą kombinacji interwencji regulacyjnych, ekonomicznych, doradczych, środowiskowych i technologicznych12. Craig i in. Continue reading “Ocena wpływu zanieczyszczenia powietrza atmosferycznego na długość życia ad”

Skumulowane wskaźniki urodzeń na żywo po zapłodnieniu in vitro

Wyniki leczenia zapłodnienia in vitro (IVF) są tradycyjnie zgłaszane jako ciąże w cyklu IVF. Jednak główną troską tej pary jest szansa na poród na żywo przez cały cykl leczenia. Metody
Oszacowaliśmy łączny współczynnik urodzeń żywych wśród pacjentów poddanych pierwszemu świeżemu embrionowi, nkonowi lub cyklowi IVF w latach 2000-2005 w jednym dużym ośrodku. Pary obserwowano aż do przerwania leczenia lub porodu żywego niemowlęcia. Analizy były stratyfikowane w zależności od wieku matki i wykonywane przy użyciu metod optymistycznych i konserwatywnych. Continue reading “Skumulowane wskaźniki urodzeń na żywo po zapłodnieniu in vitro”

Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych czesc 4

Częstość pneumokokowego zapalenia opon mózgowych, wyrażona jako liczba przypadków na 100 000 osób, została obliczona przy użyciu danych dotyczących wieku określonych w US Census Bureau (dla 1998-2000) lub specyficznych dla wieku, szacunków populacji populacyjnej (dla lat 2001-2005) .28 Ponieważ PCV7 był licencjonowany w 2000 r., Zmiany w częstości występowania pneumokokowego zapalenia opon mózgowych między okresami 2-letnimi zostały oszacowane przez porównanie wskaźników z okresów po latach 1998-1999 ze stopą w latach 1998-1999 jako ryzyko względne. Ryzyko to jest zgłaszane jako procentowe zmiany ([względne ryzyko -1] × 100) w stawkach między dwoma okresami, wraz z powiązanymi dokładnymi wartościami P. Wartości procentowe porównano z użyciem dokładnego testu Fishera, a trendy zbadano za pomocą testu trendu Cochran-Armitage. Wszystkie analizy podgrup zostały wstępnie zdefiniowane. Dwustronne wartości P mniejsze niż 0,05 uważano za wskazujące na istotność statystyczną i nie skorygowano ich pod kątem wielokrotnego testowania. Continue reading “Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych czesc 4”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej czesc 4

Ścieżka 2 pokazuje zamplifikowany przez produkt DNA z pełnej krwi z ludzkiej kontroli i pokazuje produkt .-globiny. Ścieżki 3 i 4 przedstawiają zamplifikowane DNA odpowiednio od pacjentów w Przypadku i Przypadku 2, po prezentacji. Zarówno produkty specyficzne dla .-globiny jak i Whipple a są widoczne. Ścieżki 5, 6, 7 i 8 pokazują próbki kontrolne amplifikowane DNA uzyskanym w Przypadek 2 po trzech miesiącach terapii i DNA odpowiednio z A. pyogenes, M. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej czesc 4”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd

Mikroskopię elektronową wykonano na stałej krwi obwodowej barwionej i zatopionej w ośrodku Spurra. Badania molekularne
W Przypadku DNA ekstrahowano z kilku wybarwionych przez Romanovsky szkiełek z krwi obwodowej przechowywanych w temperaturze pokojowej przez 14 lat13. W Przypadku 2, całkowite DNA komórkowe ekstrahowano z pełnej krwi, którą uzyskano podczas prezentacji i po trzech miesiącach antybiotykoterapii i przechowywano w -70 ° C14.
DNA (5 .g w Przypadku i 10 ng w Przypadku 2) zmieszano ze starterami swoistymi dla wirusa Whipple a pW3FE (5 GGAATTCCAGAGATACGCCCCCCGCAA3 ) i pW2RB (5 ATTCGCTCCACCTTGCGA3 ) 8 i ze starterami (PCO3 i PCO4), które wzmacniają 110-zasadowa para (bp) sekwencji ludzkiego .-globiny15. Primery syntetyzowano na syntezatorze DNA / RNA 392 (Applied Biosystems, Foster City, CA); specyficzne dla choroby Whipple a oligomery odpowiadały regionom obejmującym nukleotydy od 965 do 983 (PW3FE) i od 1214 do 1231 (PW2RB) genu 16S rRNA T. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad

Organizmy poplamione słabo plamą Grama, ale okazały się gram-dodatnie. Organizmy nie mogły być hodowane i nie powodowały infekcji u pięciu gatunków splenektomizowanych zwierząt. Wyniki badań serologicznych nie były diagnostyczne. Pacjent był leczony dożylnie wankomycyną i cefazoliną przez 30 dni, z doskonałą odpowiedzią kliniczną. Miał wielokrotne nawroty, ale reagował na podobne kursy cefazoliny. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad”