Zatrzymywanie vs. Kontynuacja aspiryny przed operacją tętnic wieńcowych cd

Podział leczenia został rozwarstwiony według miejsca badania za pomocą permutowanych bloków. Wszyscy pacjenci otrzymali standardową opiekę chirurgiczną i inną opiekę okołooperacyjną, w tym dobór żył i pobierania przewodów tętniczych, określenie zakresu potrzebnego szczepienia zgodnie z wynikami koronarografii, ochrony mięśnia sercowego, hemostazy chirurgicznej, terapii inotropowej i opieki pooperacyjnej. Nie było ograniczeń dotyczących stosowania pooperacyjnej aspiryny lub innej terapii przeciwpłytkowej, a taką terapię stosowano zgodnie z lokalnymi praktykami.
Warfarynę i klopidogrel należy przerwać co najmniej 7 dni przed operacją; ustąpienie innych terapii przeciwpłytkowych i przeciwzakrzepowych przeprowadzono zgodnie z lokalnymi praktykami. W tym projekcie czynnikowym pacjenci zostali losowo przydzieleni, w stosunku 1: 1, do otrzymywania aspiryny lub placebo (podawanej do 2 godzin przed operacją). Dostarczyliśmy wytycznych dotyczących postępowania w przypadku nadmiernego krwawienia po operacjach na pompach lub po operacjach poza pompą i transfuzji krwi; szczegóły znajdują się w dodatkowym dodatku.
Tabela 1. Continue reading “Zatrzymywanie vs. Kontynuacja aspiryny przed operacją tętnic wieńcowych cd”

Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych ad

Jednak u osób niezakażonych ludzkim wirusem niedoboru odporności (HIV) wzrost częstości inwazyjnej choroby pneumokokowej z serotypów innych niż PCV7 był niewielki w porównaniu z redukcją choroby serologicznej PCV7.9,17 Brak istotnego wzrostu częstości serotypu inwazyjnego serotypu innego niż PCV7, pomimo zwiększonej kolonizacji nosowo-gardłowej z serotypami nie-PCV7, jest prawdopodobnie spowodowany zmniejszonym potencjałem inwazyjnym niektórych serotypów innych niż PCV7.18 W przeciwieństwie do tego, wzrost inwazyjnej choroby serologicznej nie-PCV7 u osób dorosłych z HIV infekcja jest znaczna, prawdopodobnie odzwierciedla zwiększoną wrażliwość tej upośledzonej odporności populacji na serotypy inne niż PCV7. Aktywny nadzór nad rakiem bakterii, będący składnikiem Sieci Centrów Zapobiegania i Zapobiegania Chorobom (CDC), prowadził ciągły, aktywny, oparty na laboratoriach i oparty na populacji nadzór inwazyjnej choroby pneumokokowej w ośmiu stanach.19 W poprzedniej analizie danych z nadzoru aktywnego in vitro na inwazyjną chorobę pneumokokową starszych osób dorosłych, częstość występowania zapalenia opon mózgowych u osób w wieku 50 lat lub starszych nie uległa istotnym zmianom w latach 1998-1999 i 2002-2003, podczas gdy zaobserwowano 57% spadek częstości występowania pneumokokowa bakteriemia bez rozpoznanego pierwotnego ogniska zakażenia.12 W oddzielnych badaniach dotyczących choroby pneumokokowej u niemowląt i dzieci, zarówno sieć nadzoru czynnego rdzenia bakteryjnego, jak i amerykańska grupa badana Pneumokokowa z udziałem wielu pacjentów wykazały znaczne zmniejszenie częstości występowania pneumokokowego zapalenia opon mózgowych.8, 20 W szczególności Whitney i wsp. 8 stwierdzili zmniejszenie częstości występowania pneumokoków o 56% calowe zapalenie opon mózgowych u dzieci w wieku poniżej 24 miesięcy w 2001 r. w porównaniu z okresem przed zabiegiem. Kaplan i wsp. Continue reading “Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych ad”

Odtworzenie piersi po operacji raka sutka

A 57-letni pacjent po rekonstrukcji piersi. U chorego wykonano opóźnioną autogenną rekonstrukcję prawej piersi po radioterapii i powstanie przykurczy torebkowej. Sześć miesięcy później wykonano opóźnioną rekonstrukcję prawej piersi z przeniesieniem wolnej mikrokrążenia głębokiego dolnego płata perforatora. Po całkowitym mastektomii i radioterapii jej lewą pierś została zrekonstruowana poprzez przeniesienie płata perforatora z doskonałej mikronaczyniowo-tętniczej pośladkowej. Kompleksy brodawki-otoczki rekonstruowano za pomocą przeszczepów skóry uzyskanych z pachwiny (dla otoczek) i miejscowych płatów skóry (dla brodawek sutkowych). Continue reading “Odtworzenie piersi po operacji raka sutka”

Kontynuacja intensywnej kontroli poziomu glukozy w cukrzycy typu 2

Brytyjskie prospektywne badanie cukrzycy (UKPDS) zgłoszone przez Holmana i wsp. (Wydanie 9 października) pokazuje dotychczasowy efekt intensywnej kontroli glikemii (w grupie metforminy oraz w grupie otrzymującej sulfonylomocznik lub insulinę) na podstawie wyników klinicznych u pacjentów ze świeżo zdiagnozowaną cukrzycą typu 2. UKPDS wpłynął na międzynarodowe wytyczne leczenia2, prowadząc do zalecenia stosowania metforminy jako wstępnej terapii farmakologicznej u wszystkich pacjentów z cukrzycą typu 2. Oryginalne badanie UKPDS porównywało dane dotyczące wyników u pacjentów, którzy otrzymywali metforminę w porównaniu z terapią konwencjonalną (ograniczenie dietetyczne) lub intensywną terapią (sulfonylomocznikiem lub insulinoterapią). 3 Nie opisano jednak porównań pomiędzy grupą metforminy i grupą pochodną sulfonylomocznika lub insuliny. Continue reading “Kontynuacja intensywnej kontroli poziomu glukozy w cukrzycy typu 2”

Transplantacja nerki: zasady i praktyka

Od czasu pierwszego udanego przeszczepienia nerki – na identycznych bliźniakach w Bostonie w 1954 roku – przeszczep nerki stał się wskazaną terapią schyłkowej niewydolności nerek. W ciągu ostatnich 55 lat wiele książek na temat przeszczepów narządów pojawiło się i zniknęło, ale Transplantacja nerki, opublikowana po raz pierwszy w 1979 r. I zredagowana przez Petera Morrisa, profesora chirurgii na Uniwersytecie Oksfordzkim w Nuffield, przetrwała próbę czasu i pozostaje niezakwestionowana. jako najważniejszy traktat dotyczący klinicznego przeszczepu nerki. Redaktorzy zgromadzili panel międzynarodowych ekspertów, którzy kompleksowo analizują każdy aspekt transplantacji nerek, który wpływa na wyniki pacjentów i ogólne wyniki. Continue reading “Transplantacja nerki: zasady i praktyka”

Medicaid i droga USA do krajowego ubezpieczenia zdrowotnego

Wybory prezydenckie w 2008 r. Rozpaliły długo oczekiwaną nadzieję na kompleksową reformę systemu opieki zdrowotnej. Debata polityczna zawiera odniesienia do nowych programów rządowych (być może program federalny dla nieubezpieczonych, które można kupić) i niejasne formuły dotyczące ograniczania kosztów (zazwyczaj z nadmiernie optymistyczną oceną oszczędności, które można uzyskać dzięki wykorzystaniu technologii informacji o zdrowiu). Jak na ironię, debata generalnie ignoruje to, co uważam za najbardziej wiarygodną drogę do powszechnego pokrycia: po pierwsze, rozszerzenie Medicaid o pokrycie największej części nieubezpieczonych, Amerykanów o dochodach poniżej 350% federalnego poziomu ubóstwa (około 62 000 USD dla rodziny trzech); po drugie, wymaganie od wszystkich posiadania ubezpieczenia zdrowotnego i umożliwienie ludziom, których dochody są zbyt wysokie, aby automatycznie objęli ubezpieczenie medyczne. Poprzednie wysiłki zmierzające do uchwalenia powszechnego zasięgu zawiodły częściowo dlatego, że opozycja ze strony grup interesu, takich jak środowisko biznesowe i branża ubezpieczeniowa, ma znacznie większy wpływ niż zorganizowane wsparcie dla nieubezpieczonych pracowników niskopłatnych. Continue reading “Medicaid i droga USA do krajowego ubezpieczenia zdrowotnego”

Drobne zanieczyszczenia powietrza i średnia długość życia w Stanach Zjednoczonych ad 7

Zmniejszenie o 10 .g na metr sześcienny w PM2,5 było związane ze zwiększoną oczekiwaną długością życia wynoszącą 0,95 . 0,57 dla najmniej zanieczyszczonych obszarów i 0,57 . 0,26 roku dla innych obszarów; nie było istotnej różnicy w wpływie zanieczyszczeń na obszary, które początkowo miały względnie niski lub wysoki poziom zanieczyszczeń (P.0,15). Podobnie, oszacowanie wpływu zmiany w PM2,5 nie było bardzo wrażliwe na uwzględnienie opartych na badaniach szacunków zmian poziomu obszaru metropolitalnego w rozpowszechnieniu palenia papierosów. Na przykład, gdy model 4 w Tabeli 2 został sprawdzony z wykorzystaniem danych ze 136 powiatów w 24 obszarach metropolitalnych z dopasowanymi danymi z badań dla rozpowszechnienia palenia, zmniejszenie PM2,5 o 10 .g na metr sześcienny było związane z szacowany wzrost średniej długości życia wynoszący 0,61 . Continue reading “Drobne zanieczyszczenia powietrza i średnia długość życia w Stanach Zjednoczonych ad 7”

Wpływ błon dializy w leczeniu pacjentów z ostrą niewydolnością nerek

Wskaźnik śmiertelności wśród pacjentów z ostrą niewydolnością nerek utrzymuje się na wysokim poziomie, wynoszącym od 42 do 75 procent, pomimo licznych postępów w diagnozowaniu i leczeniu tego zaburzenia1-4. Kilka współistniejących stanów, takich jak śpiączka lub zależność od respiratora, zwiększa ryzyko śmierci u pacjentów z ostrą niewydolnością nerek, a wysoka częstość występowania tych stanów może wyjaśniać utrzymującą się wysoką śmiertelność5. Śmiertelność jest wyższa wśród pacjentów z ostrą niewydolnością nerek poddawanych hemodializie niż wśród tych, którzy nie wymagają takiego leczenia6-9. Różne metody dializy i biokompatybilność membrany dializacyjnej – zdefiniowane jako zakres dopełniacza i aktywacja neutrofili – wpływają na skuteczność leczenia10. Ostatnie badania na zwierzętach wskazują, że na powrót do zdrowia po ostrej niewydolności nerek wpływa stopień infiltracji leukocytów w nerkach oraz potencjał aktywacji dopełniacza membrany dializacyjnej, na którą narażone jest zwierzę 11-13. Continue reading “Wpływ błon dializy w leczeniu pacjentów z ostrą niewydolnością nerek”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd

Mikroskopię elektronową wykonano na stałej krwi obwodowej barwionej i zatopionej w ośrodku Spurra. Badania molekularne
W Przypadku DNA ekstrahowano z kilku wybarwionych przez Romanovsky szkiełek z krwi obwodowej przechowywanych w temperaturze pokojowej przez 14 lat13. W Przypadku 2, całkowite DNA komórkowe ekstrahowano z pełnej krwi, którą uzyskano podczas prezentacji i po trzech miesiącach antybiotykoterapii i przechowywano w -70 ° C14.
DNA (5 .g w Przypadku i 10 ng w Przypadku 2) zmieszano ze starterami swoistymi dla wirusa Whipple a pW3FE (5 GGAATTCCAGAGATACGCCCCCCGCAA3 ) i pW2RB (5 ATTCGCTCCACCTTGCGA3 ) 8 i ze starterami (PCO3 i PCO4), które wzmacniają 110-zasadowa para (bp) sekwencji ludzkiego .-globiny15. Primery syntetyzowano na syntezatorze DNA / RNA 392 (Applied Biosystems, Foster City, CA); specyficzne dla choroby Whipple a oligomery odpowiadały regionom obejmującym nukleotydy od 965 do 983 (PW3FE) i od 1214 do 1231 (PW2RB) genu 16S rRNA T. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd”

Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku ad 6

Wreszcie twierdzenie, że nowsza forma leku oferowała pacjentom oszczędności, było niepełne, jeśli nie jawnie wprowadzające w błąd. Producent nie wspomniał, że nowsza forma miała wyłączność patentową poza rok 2000, podczas gdy starsza forma szybciej utraciłaby wyłączność patentową. W związku z tym niewielkie oszczędności związane z nowszą formą najprawdopodobniej zostaną zneutralizowane przez znacznie zwiększony koszt w przyszłości, ponieważ pacjenci nie będą w stanie przenieść swoich recept do łatwo dostępnej, generycznej wersji starszej wersji. W FDA jesteśmy coraz bardziej zainteresowani kampaniami zmiany, które obejmują zastąpienia innej terapii. Takie przełączniki są powszechnie postrzegane w przypadku dostawców leków wysyłkowych, którzy zawierają umowy z producentami farmaceutycznymi, aby oferować swoje produkty po niższej cenie17. Continue reading “Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku ad 6”