Zatrzymywanie vs. Kontynuacja aspiryny przed operacją tętnic wieńcowych ad 5

Minimalna różnica między grupami, którą można było wykryć przy 80% mocy, była o 24% niższa niż ryzyko względne i o 5,2 punktu procentowego niższe bezwzględne ryzyko dla aspiryny niż dla placebo. Komitet sterujący w związku z tym zdecydował się na przerwanie grupy aspiryny i przeprowadzenie ostatecznej analizy porównawczej aspiryny w porównaniu z placebo; ta decyzja została zatwierdzona przez komitet monitorujący dane i bezpieczeństwo. Część naszego badania, która obejmuje kwas traneksamowy w porównaniu z placebo, kontynuuje ostateczny cel rejestracji i zostanie zgłoszona w późniejszym czasie. Liczba pacjentów w grupie przyjmującej aspirynę na zakończenie tej części badania wynosiła 2127 (ryc. 1).
Wszyscy pacjenci, którzy zostali losowo przydzieleni do grupy otrzymującej aspirynę lub placebo i którzy przeszli operację, byli uważani za tworzący populację, która ma zamiar leczyć, do wszystkich analiz pierwotnych i wtórnych. Analizę drugorzędowych i dychotomicznych wtórnych punktów końcowych przeprowadzono za pomocą regresji dwumianowej z logarytmicznym łączem; wyniki wyrażono jako wskaźniki ryzyka z 95% przedziałami ufności. Continue reading “Zatrzymywanie vs. Kontynuacja aspiryny przed operacją tętnic wieńcowych ad 5”

Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych ad 5

Serotypy heptahalentnej koniugatowej szczepionki pneumokokowej (PCV7) wynosiły 4, 6B, 9V, 14, 18C, 19F i 23F. Serotypy pokrewne PCV7 to 6A, 9A, 9L, 9N, 18A, 18B, 18F, 19B, 19C, 23A i 23B. Serotypy inne niż PCV7 to 3, 7F, 10A, 11A, 12F, 15A, 15B / C, 16F, 19A, 22F, 33F, 35B, 35F i 38. Spośród wszystkich grup wiekowych częstość występowania pneumokokowego zapalenia opon mózgowych wywołanego przez serotypy PCV7 zmniejszyła się z 0,66 przypadku na 100 000 osób w latach 1998-1999 do 0,18 przypadku na 100 000 w latach 2004-2005 (spadek o 73,3%, p <0,001) (wykres i tabela 2). W pięciu z sześciu zbadanych grup wiekowych częstość występowania serologicznego zapalenia opon mózgowych w kierunku PCV7 zmniejszyła się istotnie w latach 1998-1999 i 2004-2005 (tabela 2), a odsetek spadków wahał się od 92,8% w populacji docelowej szczepionki (dzieci <2 wiek) do 61,6% wśród osób w wieku od 40 do 64 lat. Continue reading “Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych ad 5”

Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych cd

W 2005 r. Te obszary nadzoru stanowiły szacunkowo 18 444 432 osoby.22 Do 2000 r. Nadzór w Gruzji nie obejmował rutynowego prospektywnego gromadzenia danych na temat leżących u podstaw chorób, w tym HIV i zespołu nabytego niedoboru odporności (AIDS). W związku z tym wyłączyliśmy dane z Gruzji z lat 1998 i 1999 w celu analizy warunków podstawowych. Ponadto dane z Nowego Jorku zostały wyłączone z analiz obejmujących stratyfikację w oparciu o status HIV-AIDS, ponieważ status HIV-AIDS nie został stwierdzony w tym miejscu w żadnym roku. Continue reading “Wpływ pneumokokowej szczepionki koniugatowej na pneumokokowe zapalenie opon mózgowych cd”

Trzustka: zintegrowany podręcznik podstawowej nauki, medycyny i chirurgii

Istnieje tradycyjne przekonanie, że lekarz może podążać jedną z dwóch odrębnych ścieżek kariery: specjalność medyczna lub specjalność chirurgiczna. Każdy, kto pracuje w medycynie trzustkowej, zdaje sobie jednak sprawę, że granice między tymi ścieżkami czasami się zacierają. Aby skutecznie diagnozować i leczyć choroby trzustki, gastroenterolodzy muszą rozpoznać, kiedy konieczna jest interwencja chirurgiczna, a chirurdzy żołądkowo-jelitowi powinni zrozumieć, w jaki sposób gastroenterolodzy podchodzą do tych chorób i nimi zarządzają. Co więcej, podstawą badań nad pankreatologią jest nauka podstawowa. Ta książka, wytrawna praca nad trzustką wydaną przez Hansa Begera i innych, jest zatem trafnie nazwana. Continue reading “Trzustka: zintegrowany podręcznik podstawowej nauki, medycyny i chirurgii”

Ocena wpływu zanieczyszczenia powietrza atmosferycznego na długość życia cd

Instytut Efektów Zdrowotnych podkreślił potrzebę takich ocen, proponując ramy odpowiedzialności za zarządzanie jakością powietrza18. W ramach tych analizowane są skutki interwencji mających na celu poprawę jakości powietrza pod względem redukcji emisji, poprawy jakości powietrza, zmniejszenia narażenia ludzi, i, ostatecznie, poprawa zdrowia populacji. Ponieważ długotrwałe narażenie na zanieczyszczenie powietrza cząstkami ma znacznie większy wpływ na zdrowie populacji niż krótkotrwałe narażenie, wyniki badania Pope et al. mają szczególne znaczenie w ramach odpowiedzialności ustanowionej przez Instytut Efektów Zdrowotnych. Pope i in. Continue reading “Ocena wpływu zanieczyszczenia powietrza atmosferycznego na długość życia cd”

Ujawnianie online relacji lekarz-przemysł ad

Sześć innych stanów i Dystrykt Kolumbii ma prawa lub przepisy dotyczące prowadzenia producentów wyrobów farmaceutycznych lub urządzeń medycznych, ale tylko w stanie Minnesota ujawnienia wyraźnie wymagane są jako zapisy publiczne (www.phcybrd.state.mn.us/main_pay. htm), a ten wymóg dotyczy tylko firm farmaceutycznych. Na poziomie krajowym Kongres może nakazać ujawnienie wielu prezentów branżowych i wypłat dla lekarzy na stronie internetowej rządu federalnego z możliwością przeszukiwania, pod oczekującym aktem, znanym jako Ustawa o zasiłkach dla lekarzy. Jeśli ustawa stanie się prawem, będzie to miało wpływ na zgłaszanie stanu i wymogi dotyczące ujawnień. Ujawnienie w Internecie jest najnowszą odpowiedzią na obawy dotyczące finansowych konfliktów interesów oraz stosowności różnych związków między medycyną a przemysłem. Continue reading “Ujawnianie online relacji lekarz-przemysł ad”

Drobne zanieczyszczenia powietrza i średnia długość życia w Stanach Zjednoczonych ad 8

Wielokrotność i konkurencyjne kwestie ryzyka utrudniają określenie zmian w długości życia, które można przypisać pojedynczym czynnikom ryzyka, ale wyniki te sugerują, że indywidualny wpływ redukcji zanieczyszczenia powietrza na oczekiwaną długość życia wyniósł 15% ogólnego wzrostu. W obszarach metropolitalnych, gdzie redukcja PM2,5 wynosiła 13 do 14 .g na metr sześcienny, wkład poprawy jakości powietrza do wzrostu oczekiwanej długości życia wynosił aż 0,82 roku (13,5 × 0,061). We wcześniejszych analizach przekrojowych badacze zaobserwowali związek między współczynnikami umieralności a zanieczyszczeniem pyłem, 1-3, ale wielkość tych stowarzyszeń była wrażliwa na wysiłki mające na celu kontrolę analiz potencjalnych potencjalnych czynników zakłócających. Nasza analiza wykazała podobną wrażliwość dla ściśle powiązań przekrojowych ze średnią długością życia. Podstawową siłą tej analizy jest jednak dodatkowe wykorzystanie zmian czasowych. Continue reading “Drobne zanieczyszczenia powietrza i średnia długość życia w Stanach Zjednoczonych ad 8”

Drobne zanieczyszczenia powietrza i średnia długość życia w Stanach Zjednoczonych ad 5

Statystyki podsumowujące kluczowe zmienne badawcze zestawiono w tabeli 1. Na rys. 2 i rys. 3 spodziewane długości życia przekrojów są obliczane odpowiednio dla danych dotyczących zanieczyszczenia powietrza odpowiednio dla wcześniejszych i późniejszych okresów. Na podstawie danych przedstawionych na tych dwóch rysunkach można sporządzić co najmniej pięć obserwacji: stężenia PM2,5 zmniejszyły się zasadniczo w latach 80. Continue reading “Drobne zanieczyszczenia powietrza i średnia długość życia w Stanach Zjednoczonych ad 5”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd

Mikroskopię elektronową wykonano na stałej krwi obwodowej barwionej i zatopionej w ośrodku Spurra. Badania molekularne
W Przypadku DNA ekstrahowano z kilku wybarwionych przez Romanovsky szkiełek z krwi obwodowej przechowywanych w temperaturze pokojowej przez 14 lat13. W Przypadku 2, całkowite DNA komórkowe ekstrahowano z pełnej krwi, którą uzyskano podczas prezentacji i po trzech miesiącach antybiotykoterapii i przechowywano w -70 ° C14.
DNA (5 .g w Przypadku i 10 ng w Przypadku 2) zmieszano ze starterami swoistymi dla wirusa Whipple a pW3FE (5 GGAATTCCAGAGATACGCCCCCCGCAA3 ) i pW2RB (5 ATTCGCTCCACCTTGCGA3 ) 8 i ze starterami (PCO3 i PCO4), które wzmacniają 110-zasadowa para (bp) sekwencji ludzkiego .-globiny15. Primery syntetyzowano na syntezatorze DNA / RNA 392 (Applied Biosystems, Foster City, CA); specyficzne dla choroby Whipple a oligomery odpowiadały regionom obejmującym nukleotydy od 965 do 983 (PW3FE) i od 1214 do 1231 (PW2RB) genu 16S rRNA T. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad

Organizmy poplamione słabo plamą Grama, ale okazały się gram-dodatnie. Organizmy nie mogły być hodowane i nie powodowały infekcji u pięciu gatunków splenektomizowanych zwierząt. Wyniki badań serologicznych nie były diagnostyczne. Pacjent był leczony dożylnie wankomycyną i cefazoliną przez 30 dni, z doskonałą odpowiedzią kliniczną. Miał wielokrotne nawroty, ale reagował na podobne kursy cefazoliny. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad”