Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd

Mikroskopię elektronową wykonano na stałej krwi obwodowej barwionej i zatopionej w ośrodku Spurra. Badania molekularne
W Przypadku DNA ekstrahowano z kilku wybarwionych przez Romanovsky szkiełek z krwi obwodowej przechowywanych w temperaturze pokojowej przez 14 lat13. W Przypadku 2, całkowite DNA komórkowe ekstrahowano z pełnej krwi, którą uzyskano podczas prezentacji i po trzech miesiącach antybiotykoterapii i przechowywano w -70 ° C14.
DNA (5 .g w Przypadku i 10 ng w Przypadku 2) zmieszano ze starterami swoistymi dla wirusa Whipple a pW3FE (5 GGAATTCCAGAGATACGCCCCCCGCAA3 ) i pW2RB (5 ATTCGCTCCACCTTGCGA3 ) 8 i ze starterami (PCO3 i PCO4), które wzmacniają 110-zasadowa para (bp) sekwencji ludzkiego .-globiny15. Primery syntetyzowano na syntezatorze DNA / RNA 392 (Applied Biosystems, Foster City, CA); specyficzne dla choroby Whipple a oligomery odpowiadały regionom obejmującym nukleotydy od 965 do 983 (PW3FE) i od 1214 do 1231 (PW2RB) genu 16S rRNA T. whippelii. Końcowa objętość reakcji wynosiła 100 mikrolitrów, zawierających 250 .moli każdego trifosforanu deoksyrybonukleozydu i 2,5 mM chlorku magnezu. Mieszaniny reakcyjne przeniesiono do Thermocycler 480 (Perkin-Elmer, Emeryville, CA), a domenę docelową amplifikowano przez PCR w 30 cyklach w standardowy sposób. Próbki kontrolne DNA pełnej krwi od normalnego osobnika lub DNA z organizmów filogenetycznie powiązanych z T. whippelii (tj. Actinomyces pyogenes, Micrococcus luteus i Mycobacterium chelonei) amplifikowano w podobny sposób. Zawarte w tych mieszaninach reakcyjnych były także startery dla sekwencji genu .-globiny (normalna kontrola ludzka) lub zestaw starterów (p515FPL8 i p11p11) dla zakonserwowanych sekwencji genów 16R rRNA eubakterii (spokrewnione organizmy). Produkty PCR wykrywano za pomocą elektroforezy na 2,0% żelu agarozowym zawierającym bromek etydyny. Produkty amplifikowane za pomocą PCR sekwencjonowano bezpośrednio stosując metodę dideoksy z oligonukleotydami stosowanymi do PCR jako starterów.
Wyniki
Rysunek 1. Rysunek 1. Filmy krwi obwodowej pacjentów z przypadku i przypadku 2. Folia krwi uzyskana przy przyjęciu w przypadku (panel A) pokazuje małe organizmy związane z erytrocytami (strzałki) (plama Wrighta, x4300, oglądana pod zanurzeniem oleju). Folia uzyskana w Przypadku 2 (Panel B) pokazuje organizmy związane z erytrocytami (barwnik Wrighta, x4800, oglądany pod wpływem zanurzenia w oleju).
Wybarwienia Wrighta w krwi obwodowej obu pacjentów ujawniły krótkie, niebiesko-fioletowe pręciki związane z wieloma erytrocytami (ryc. 1). Pręty te rzadko były postrzegane jako leżące swobodnie i nie były widziane w związku z leukocytami. Barwienie Grama zidentyfikowało te pręty jako pałeczki Gram-dodatnie (nie pokazane). W drugim przypadku trudno było znaleźć organizmy związane z krwinkami czerwonymi w trzecim dniu leczenia penicyliną, a organizmów nie można było już zobaczyć po pięciu dniach. U obydwu pacjentów badanie mikroskopowe tych prętów w przekroju podłużnym wykazało obecność trilamellarnej błony zewnętrznej na ścianie komórkowej, cechy typowej dla Bacillusa Whipple a.
Figura 2. Figura 2. Fragmenty rybosomalnego DNA z amplifikacją PCR 16S. Ścieżka pokazuje marker DNA
[patrz też: granulocyty kwasochłonne, polprofili, cardiomin ]

Powiązane tematy z artykułem: cardiomin granulocyty kwasochłonne polprofili