Wpływ błon dializy w leczeniu pacjentów z ostrą niewydolnością nerek

Wskaźnik śmiertelności wśród pacjentów z ostrą niewydolnością nerek utrzymuje się na wysokim poziomie, wynoszącym od 42 do 75 procent, pomimo licznych postępów w diagnozowaniu i leczeniu tego zaburzenia1-4. Kilka współistniejących stanów, takich jak śpiączka lub zależność od respiratora, zwiększa ryzyko śmierci u pacjentów z ostrą niewydolnością nerek, a wysoka częstość występowania tych stanów może wyjaśniać utrzymującą się wysoką śmiertelność5. Śmiertelność jest wyższa wśród pacjentów z ostrą niewydolnością nerek poddawanych hemodializie niż wśród tych, którzy nie wymagają takiego leczenia6-9. Różne metody dializy i biokompatybilność membrany dializacyjnej – zdefiniowane jako zakres dopełniacza i aktywacja neutrofili – wpływają na skuteczność leczenia10. Ostatnie badania na zwierzętach wskazują, że na powrót do zdrowia po ostrej niewydolności nerek wpływa stopień infiltracji leukocytów w nerkach oraz potencjał aktywacji dopełniacza membrany dializacyjnej, na którą narażone jest zwierzę 11-13. Continue reading “Wpływ błon dializy w leczeniu pacjentów z ostrą niewydolnością nerek”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad 5

Nasze badanie dostarcza dalszych dowodów na poparcie tego związku. Wykryliśmy prątki związane z erytrocytami u dwóch pacjentów, którzy mieli historię zgodną z chorobą Whipple a. Wyizolowanie DNA T. whippelii z krwi, miejsca, które pozostało negatywne pod względem kulturowym, implikuje ten organizm jako przyczynę choroby u tych pacjentów. Startery swoiste dla choroby Whipple a nie wytworzyły produktu z DNA pełnej krwi uzyskanym od pacjenta w Przypadku 2 po trzech miesiącach terapii lub DNA uzyskanym z filogenetycznie pokrewnych organizmów. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad 5”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej czesc 4

Ścieżka 2 pokazuje zamplifikowany przez produkt DNA z pełnej krwi z ludzkiej kontroli i pokazuje produkt .-globiny. Ścieżki 3 i 4 przedstawiają zamplifikowane DNA odpowiednio od pacjentów w Przypadku i Przypadku 2, po prezentacji. Zarówno produkty specyficzne dla .-globiny jak i Whipple a są widoczne. Ścieżki 5, 6, 7 i 8 pokazują próbki kontrolne amplifikowane DNA uzyskanym w Przypadek 2 po trzech miesiącach terapii i DNA odpowiednio z A. pyogenes, M. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej czesc 4”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd

Mikroskopię elektronową wykonano na stałej krwi obwodowej barwionej i zatopionej w ośrodku Spurra. Badania molekularne
W Przypadku DNA ekstrahowano z kilku wybarwionych przez Romanovsky szkiełek z krwi obwodowej przechowywanych w temperaturze pokojowej przez 14 lat13. W Przypadku 2, całkowite DNA komórkowe ekstrahowano z pełnej krwi, którą uzyskano podczas prezentacji i po trzech miesiącach antybiotykoterapii i przechowywano w -70 ° C14.
DNA (5 .g w Przypadku i 10 ng w Przypadku 2) zmieszano ze starterami swoistymi dla wirusa Whipple a pW3FE (5 GGAATTCCAGAGATACGCCCCCCGCAA3 ) i pW2RB (5 ATTCGCTCCACCTTGCGA3 ) 8 i ze starterami (PCO3 i PCO4), które wzmacniają 110-zasadowa para (bp) sekwencji ludzkiego .-globiny15. Primery syntetyzowano na syntezatorze DNA / RNA 392 (Applied Biosystems, Foster City, CA); specyficzne dla choroby Whipple a oligomery odpowiadały regionom obejmującym nukleotydy od 965 do 983 (PW3FE) i od 1214 do 1231 (PW2RB) genu 16S rRNA T. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad

Organizmy poplamione słabo plamą Grama, ale okazały się gram-dodatnie. Organizmy nie mogły być hodowane i nie powodowały infekcji u pięciu gatunków splenektomizowanych zwierząt. Wyniki badań serologicznych nie były diagnostyczne. Pacjent był leczony dożylnie wankomycyną i cefazoliną przez 30 dni, z doskonałą odpowiedzią kliniczną. Miał wielokrotne nawroty, ale reagował na podobne kursy cefazoliny. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej

Choroba Whipple a jest ogólnoustrojową infekcją charakteryzującą się najczęściej gorączką, utratą masy ciała, biegunką, zapaleniem wielostawowym i adenopatią1,2. Próby hodowania organizmu sprawczego okazały się nieskuteczne, ale badanie mikroskopowe zainfekowanej tkanki, zazwyczaj próbek pobranych z małych biopsji lub węzłów chłonnych, ujawnia drobne pręciki Gram-dodatnie, które wyglądają jak wtrętowe intracytoplazmatyczne diastazy na kwasowym barwieniu-Schiff2. Mikroskopia elektronowa ujawnia, że te drobnoustroje mają membranę trilamellarną na zewnątrz ściany komórkowej, co zwykle wiąże się z bakteriami Gram-ujemnymi3,4. Niedawne badania wykazały, że specyficzna identyfikacja patogenów bakteryjnych nie wymaga hodowli, ale może być osiągnięta poprzez analizę molekularną bakteryjnego genu rybosomalnego RNA 16S (rRNA) wyizolowanego z zainfekowanej tkanki5-8. Ten gen obejmuje kilka wysoce konserwatywnych domen podzielonych między domeny specyficzne dla gatunku. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej”

Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku ad 6

Wreszcie twierdzenie, że nowsza forma leku oferowała pacjentom oszczędności, było niepełne, jeśli nie jawnie wprowadzające w błąd. Producent nie wspomniał, że nowsza forma miała wyłączność patentową poza rok 2000, podczas gdy starsza forma szybciej utraciłaby wyłączność patentową. W związku z tym niewielkie oszczędności związane z nowszą formą najprawdopodobniej zostaną zneutralizowane przez znacznie zwiększony koszt w przyszłości, ponieważ pacjenci nie będą w stanie przenieść swoich recept do łatwo dostępnej, generycznej wersji starszej wersji. W FDA jesteśmy coraz bardziej zainteresowani kampaniami zmiany, które obejmują zastąpienia innej terapii. Takie przełączniki są powszechnie postrzegane w przypadku dostawców leków wysyłkowych, którzy zawierają umowy z producentami farmaceutycznymi, aby oferować swoje produkty po niższej cenie17. Continue reading “Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku ad 6”

Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku ad 5

Podejmowanie decyzji na podstawie nieodpowiednich danych dotyczących porównywalnej skuteczności i efektywności kosztowej może spowodować zwiększenie, a nie zmniejszenie kosztów opieki zdrowotnej. Zmień kampanie
Firmy farmaceutyczne, a także podmioty świadczące usługi opieki zdrowotnej i ich przedstawiciele, coraz częściej starają się zmienić pacjentów z oryginalnie przepisanych leków na leki ja też sprzedawane przez firmy. Próby te są czasami określane jako zmiany kampanii . Po odpowiednim przełączeniu zmiana może poprawić jakość opieki, obniżyć koszty lub obu. Na przykład przejście z markowego produktu na tańszy, biorównoważny produkt generyczny może zmniejszyć wydatki pacjenta i ogólne wydatki na opiekę zdrowotną, bez wpływu na jakość opieki. Continue reading “Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku ad 5”

Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku czesc 4

Produkty przeciwwrzodowe, które są również stosowane w leczeniu choroby refluksowej przełyku, stanowią lukratywną, wysoce konkurencyjną kategorię terapeutyczną, w której sponsorzy czasami wykorzystują nieulepszone i względnie nieistotne różnice, aby odróżnić swoje produkty od konkurencyjnych. Często deklarowane rozbieżności dotyczą względnego bezpieczeństwa. FDA podjęła działania przeciwko sponsorowi, który zaangażował się w długotrwały i szeroko zakrojony wysiłek, aby dyskredytować względne bezpieczeństwo konkurencyjnego produktu. Sponsor przeinaczył ryzyko interakcji lekowych związanych z jego produktem w odniesieniu do ryzyka związanego z konkurującym produktem, selektywnie wykorzystując negatywne raporty kliniczne i pomijając pewne ważne interakcje leków związane z jego własnym produktem. Sponsor również nieprawidłowo scharakteryzował dane, aby zasugerować, że produkt konkurencji był związany z negatywnymi efektami hemodynamicznymi, gdy skutki te nie zostały udokumentowane w dawkach terapeutycznych. Continue reading “Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku czesc 4”

Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku cd

Zazwyczaj badania te obejmują wprowadzenie nowego leku w zatłoczonej klasie terapeutycznej. Sukces takiego nowego produktu może zależeć od złagodzenia wygodnych nawyków lekarzy dotyczących przepisywania konkurencyjnego, bardziej ugruntowanego produktu. Jeden z przykładów próby wysiewania wiązał się z dużym projektem związanym z wprowadzeniem nowego leku przeciwnadciśnieniowego, spóźniacza do swojej klasy terapeutycznej. Określonymi celami badania była ocena skuteczności i tolerancji tego środka w kontrolowaniu łagodnego do umiarkowanego nadciśnienia. Sponsor wykorzystał swoje siły sprzedaży do rekrutacji 2500 biurowych badaczy, którzy byli częstymi lekarzami przepisującymi leki w danej klasie terapeutycznej. Continue reading “Wojny terapeutyczne – promocja narkotyków na konkurencyjnym rynku cd”