Wpływ błon dializy w leczeniu pacjentów z ostrą niewydolnością nerek

Wskaźnik śmiertelności wśród pacjentów z ostrą niewydolnością nerek utrzymuje się na wysokim poziomie, wynoszącym od 42 do 75 procent, pomimo licznych postępów w diagnozowaniu i leczeniu tego zaburzenia1-4. Kilka współistniejących stanów, takich jak śpiączka lub zależność od respiratora, zwiększa ryzyko śmierci u pacjentów z ostrą niewydolnością nerek, a wysoka częstość występowania tych stanów może wyjaśniać utrzymującą się wysoką śmiertelność5. Śmiertelność jest wyższa wśród pacjentów z ostrą niewydolnością nerek poddawanych hemodializie niż wśród tych, którzy nie wymagają takiego leczenia6-9. Różne metody dializy i biokompatybilność membrany dializacyjnej – zdefiniowane jako zakres dopełniacza i aktywacja neutrofili – wpływają na skuteczność leczenia10. Ostatnie badania na zwierzętach wskazują, że na powrót do zdrowia po ostrej niewydolności nerek wpływa stopień infiltracji leukocytów w nerkach oraz potencjał aktywacji dopełniacza membrany dializacyjnej, na którą narażone jest zwierzę 11-13. Continue reading “Wpływ błon dializy w leczeniu pacjentów z ostrą niewydolnością nerek”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad 5

Nasze badanie dostarcza dalszych dowodów na poparcie tego związku. Wykryliśmy prątki związane z erytrocytami u dwóch pacjentów, którzy mieli historię zgodną z chorobą Whipple a. Wyizolowanie DNA T. whippelii z krwi, miejsca, które pozostało negatywne pod względem kulturowym, implikuje ten organizm jako przyczynę choroby u tych pacjentów. Startery swoiste dla choroby Whipple a nie wytworzyły produktu z DNA pełnej krwi uzyskanym od pacjenta w Przypadku 2 po trzech miesiącach terapii lub DNA uzyskanym z filogenetycznie pokrewnych organizmów. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej ad 5”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej czesc 4

Ścieżka 2 pokazuje zamplifikowany przez produkt DNA z pełnej krwi z ludzkiej kontroli i pokazuje produkt .-globiny. Ścieżki 3 i 4 przedstawiają zamplifikowane DNA odpowiednio od pacjentów w Przypadku i Przypadku 2, po prezentacji. Zarówno produkty specyficzne dla .-globiny jak i Whipple a są widoczne. Ścieżki 5, 6, 7 i 8 pokazują próbki kontrolne amplifikowane DNA uzyskanym w Przypadek 2 po trzech miesiącach terapii i DNA odpowiednio z A. pyogenes, M. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej czesc 4”

Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd

Mikroskopię elektronową wykonano na stałej krwi obwodowej barwionej i zatopionej w ośrodku Spurra. Badania molekularne
W Przypadku DNA ekstrahowano z kilku wybarwionych przez Romanovsky szkiełek z krwi obwodowej przechowywanych w temperaturze pokojowej przez 14 lat13. W Przypadku 2, całkowite DNA komórkowe ekstrahowano z pełnej krwi, którą uzyskano podczas prezentacji i po trzech miesiącach antybiotykoterapii i przechowywano w -70 ° C14.
DNA (5 .g w Przypadku i 10 ng w Przypadku 2) zmieszano ze starterami swoistymi dla wirusa Whipple a pW3FE (5 GGAATTCCAGAGATACGCCCCCCGCAA3 ) i pW2RB (5 ATTCGCTCCACCTTGCGA3 ) 8 i ze starterami (PCO3 i PCO4), które wzmacniają 110-zasadowa para (bp) sekwencji ludzkiego .-globiny15. Primery syntetyzowano na syntezatorze DNA / RNA 392 (Applied Biosystems, Foster City, CA); specyficzne dla choroby Whipple a oligomery odpowiadały regionom obejmującym nukleotydy od 965 do 983 (PW3FE) i od 1214 do 1231 (PW2RB) genu 16S rRNA T. Continue reading “Rozpoznanie choroby Whipplea za pomocą analizy molekularnej krwi obwodowej cd”